Top » Catalog » R1b » A260

$18.00

A260
[A260]

A260
hg38 Position: ChrY:20699651..20699651
Ancestral: G
Derived: A
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a3a
Comments: Downstream R1b-M222/S660
Forward Primer: A260_F CTGGGCAGTCATTACAGCAG
Reverse Primer: A260_R TGCCACTTTCATATGCCTTG
Reviews

Customers who bought this product also purchased
M253
M253
Y3685
Y3685
S2679
S2679
FGC15072
FGC15072
M9
M9
L1193
L1193
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies