Top » Catalog » R1b » A260

$18.00

A260
[A260]

A260
hg38 Position: ChrY:20699651..20699651
Ancestral: G
Derived: A
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a3a
Comments: Downstream R1b-M222/S660
Forward Primer: A260_F CTGGGCAGTCATTACAGCAG
Reverse Primer: A260_R TGCCACTTTCATATGCCTTG
Reviews

Customers who bought this product also purchased
M438
M438
F21841
F21841
Z2079
Z2079
I2a-M284 Panel
I2a-M284 Panel
M96
M96
FGC14249
FGC14249
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies