Top » Catalog » R1b » A260

$18.00

A260
[A260]

A260
hg38 Position: ChrY:20699651..20699651
Ancestral: G
Derived: A
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a3a
Comments: Downstream R1b-M222/S660
Forward Primer: A260_F CTGGGCAGTCATTACAGCAG
Reverse Primer: A260_R TGCCACTTTCATATGCCTTG
Reviews

Customers who bought this product also purchased
A21190
A21190
BY18113
BY18113
BY18119
BY18119
Y96121
Y96121
BY132382
BY132382
Y132143
Y132143
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A994
1 x A1718
1 x A948
1 x A294
1 x A995
1 x A2260
1 x A1182
1 x A149
1 x A926
1 x A537
1 x A2119
1 x A392
1 x A2258
1 x A368
$252.00
Haplogroup Info
Other products
Currencies