Top » Catalog » R1b » A260

$18.00

A260
[A260]

A260
hg38 Position: ChrY:20699651..20699651
Ancestral: G
Derived: A
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a3a
Comments: Downstream R1b-M222/S660
Forward Primer: A260_F CTGGGCAGTCATTACAGCAG
Reverse Primer: A260_R TGCCACTTTCATATGCCTTG
Reviews

Customers who bought this product also purchased
FGC59201
FGC59201
A21757
A21757
A21762
A21762
BY20588
BY20588
BY20816
BY20816
YFS2134321
YFS2134321
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies