Top » Catalog » R1b » A223

$18.00

A223
[A223]

A223
hg38 Position: ChrY:12106147..12106147
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a4
Comments: R1b-M222/S660
Forward Primer: A223_F TCCTGAGGCATGCGCATC
Reverse Primer: A223_R GGAGTCCTGTACATGTACATGCAC
Reviews

Customers who bought this product also purchased
P312
P312
M343
M343
Y150210
Y150210
M9
M9
BY108617
BY108617
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies