Top » Catalog » R1b » A223

$18.00

A223
[A223]

A223
hg38 Position: ChrY:12106147..12106147
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a4
Comments: R1b-M222/S660
Forward Primer: A223_F TCCTGAGGCATGCGCATC
Reverse Primer: A223_R GGAGTCCTGTACATGTACATGCAC
Reviews

Customers who bought this product also purchased
A984
A984
A10528
A10528
BY18130
BY18130
BY11697
BY11697
A10642
A10642
FGC46309
FGC46309
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A965
1 x A315
1 x A170
1 x A2137
1 x A1277
$90.00
Haplogroup Info
Other products
Currencies