Top » Catalog » R1b » A223

$18.00

A223
[A223]

A223
hg38 Position: ChrY:12106147..12106147
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a4
Comments: R1b-M222/S660
Forward Primer: A223_F TCCTGAGGCATGCGCATC
Reverse Primer: A223_R GGAGTCCTGTACATGTACATGCAC
Reviews

Customers who bought this product also purchased
L51
L51
P312
P312
M343
M343
Y150210
Y150210
M9
M9
BY108617
BY108617
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies