Top » Catalog » R1b » A274

$19.00

A274
[A274]

A274
hg38 Position: ChrY:19226078..19226078
Ancestral: C
Derived: T
Reference: M. Engelen (2014)
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: Downstream of R-U152*
Forward Primer: A274_F TTCCCTGTTCCTTGATGCTC
Reverse Primer: A274_R GGTTGCATCCTTCTGTGGTC
Reviews

Customers who bought this product also purchased
BY65966
BY65966
FTA17505
FTA17505
FT249048
FT249048
FTA10243
FTA10243
BY54584
BY54584
BY3631
BY3631
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies