Top » Catalog » R1b » A274

$18.00

A274
[A274]

A274
hg38 Position: ChrY:19226078..19226078
Ancestral: C
Derived: T
Reference: M. Engelen (2014)
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: Downstream of R-U152*
Forward Primer: A274_F TTCCCTGTTCCTTGATGCTC
Reverse Primer: A274_R GGTTGCATCCTTCTGTGGTC
Reviews

Customers who bought this product also purchased
L51
L51
A12510
A12510
M343
M343
U152
U152
FGC5058
FGC5058
M9
M9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies