Top » Catalog » R1b » A274

$18.00

A274
[A274]

A274
hg38 Position: ChrY:19226078..19226078
Ancestral: C
Derived: T
Reference: M. Engelen (2014)
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: Downstream of R-U152*
Forward Primer: A274_F TTCCCTGTTCCTTGATGCTC
Reverse Primer: A274_R GGTTGCATCCTTCTGTGGTC
Reviews

Customers who bought this product also purchased
L51
L51
BY3647
BY3647
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
BY3856
BY3856
P312
P312
PF6645
PF6645
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies