Top » Catalog » R1b » A274

$18.00

A274
[A274]

A274
hg38 Position: ChrY:19226078..19226078
Ancestral: C
Derived: T
Reference: M. Engelen (2014)
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: Downstream of R-U152*
Forward Primer: A274_F TTCCCTGTTCCTTGATGCTC
Reverse Primer: A274_R GGTTGCATCCTTCTGTGGTC
Reviews

Customers who bought this product also purchased
BY3851
BY3851
SK2076
SK2076
Z2103
Z2103
PF7563
PF7563
BY177884
BY177884
Y140068
Y140068
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies