Top » Catalog » R1b » A274

$18.00

A274
[A274]

A274
hg38 Position: ChrY:19226078..19226078
Ancestral: C
Derived: T
Reference: M. Engelen (2014)
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: Downstream of R-U152*
Forward Primer: A274_F TTCCCTGTTCCTTGATGCTC
Reverse Primer: A274_R GGTTGCATCCTTCTGTGGTC
Reviews

Customers who bought this product also purchased
L51
L51
FGC5058
FGC5058
Z30038
Z30038
M9
M9
L21
L21
BY3647
BY3647
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2263
1 x A500
1 x A698
1 x A1168
$72.00
Haplogroup Info
Other products
Currencies