Top » Catalog » R1b » A275

$18.00

A275
[A275]

A275
hg38 Position: ChrY:11512813..11512813
Ancestral: T
Derived: C
Reference: M. Engelen (2014)
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: Downstream of R-U152*
Forward Primer: A275_F TGGTCTTCAAAGGAATTTATGG
Reverse Primer: A275_R TACTCCATTCCGATCGGTTC
Reviews

Customers who bought this product also purchased
Z192
Z192
PF6645
PF6645
L21
L21
Z56
Z56
S8024
S8024
P312
P312
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies