Top » Catalog » R1b » A275

$18.00

A275
[A275]

A275
hg38 Position: ChrY:11512813..11512813
Ancestral: T
Derived: C
Reference: M. Engelen (2014)
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: Downstream of R-U152*
Forward Primer: A275_F TGGTCTTCAAAGGAATTTATGG
Reverse Primer: A275_R TACTCCATTCCGATCGGTTC
Reviews

Customers who bought this product also purchased
S8024
S8024
P312
P312
L2
L2
CTS5531
CTS5531
L51
L51
R1b-U152 Superclade Panel
R1b-U152 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1308
1 x A195
1 x A1024
1 x A149
1 x A2207
1 x A220
$108.00
Haplogroup Info
Other products
Currencies