Top » Catalog » R1b » A275

$18.00

A275
[A275]

A275
hg38 Position: ChrY:11512813..11512813
Ancestral: T
Derived: C
Reference: M. Engelen (2014)
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: Downstream of R-U152*
Forward Primer: A275_F TGGTCTTCAAAGGAATTTATGG
Reverse Primer: A275_R TACTCCATTCCGATCGGTTC
Reviews

Customers who bought this product also purchased
R1b-U152 Superclade Panel
R1b-U152 Superclade Panel
A7969
A7969
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
DF19
DF19
Y17161
Y17161
U152
U152
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1283
1 x A1489
1 x A2254
1 x A1153
$72.00
Haplogroup Info
Other products
Currencies