Top » Catalog » R1b » A206

$18.00

A206
[A206]

A206
hg38 Position: ChrY:7309500..7309500
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b1
Comments: Found in a R1b-CTS4466 person
Forward Primer: A206_F TTTGCCACTTGGACACATTG
Reverse Primer: A206_R TGCACAGAAAACACAAAATGC
Reviews

Customers who bought this product also purchased
A214
A214
A350
A350
A293
A293
A344
A344
A212
A212
A349
A349
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies