Top » Catalog » R1b » A208

$18.00

A208
[A208]

A208
hg38 Position: ChrY:12252265..12252265
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Found in a R1b-CTS4466 person
Forward Primer: A208_F GATTTTGTGCACAGCTCGTC
Reverse Primer: A208_R AACTGAATCAGGGCAGGATG
Reviews

Customers who bought this product also purchased
A340
A340
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
A347
A347
A218
A218
A352
A352
A338
A338
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies