Top » Catalog » R1b » A208

$18.00

A208
[A208]

A208
hg38 Position: ChrY:12252265..12252265
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Found in a R1b-CTS4466 person
Forward Primer: A208_F GATTTTGTGCACAGCTCGTC
Reverse Primer: A208_R AACTGAATCAGGGCAGGATG
Reviews

Customers who bought this product also purchased
A344
A344
A212
A212
A349
A349
A292
A292
A355
A355
A342
A342
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A426
$18.00
Haplogroup Info
Other products
Currencies