Top » Catalog » R1b » A208

$18.00

A208
[A208]

A208
hg38 Position: ChrY:12252265..12252265
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Found in a R1b-CTS4466 person
Forward Primer: A208_F GATTTTGTGCACAGCTCGTC
Reverse Primer: A208_R AACTGAATCAGGGCAGGATG
Reviews

Customers who bought this product also purchased
A216
A216
A351
A351
A337
A337
A346
A346
A214
A214
A350
A350
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies