Top » Catalog » R1b » A210

$18.00

A210
[A210]

A210
hg38 Position: ChrY:13046272..13046272
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b1
Comments: Found in a R1b-CTS4466 person
Forward Primer: A210_F TCCAATAGCCAAAGCATTCC
Reverse Primer: A210_R GCTTTTGAGCCATTTGCTTC
Reviews

Customers who bought this product also purchased
A344
A344
A211
A211
A349
A349
A292
A292
A355
A355
A342
A342
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2196
1 x A2223
$36.00
Haplogroup Info
Other products
Currencies