Top » Catalog » R1b » A210

$18.00

A210
[A210]

A210
hg38 Position: ChrY:13046272..13046272
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b1
Comments: Found in a R1b-CTS4466 person
Forward Primer: A210_F TCCAATAGCCAAAGCATTCC
Reverse Primer: A210_R GCTTTTGAGCCATTTGCTTC
Reviews

Customers who bought this product also purchased
A211
A211
A349
A349
A292
A292
A355
A355
A342
A342
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A907
1 x A62
1 x A71
1 x A214
1 x A119
1 x A700
1 x A594
1 x A1066
1 x A1715
1 x A421
1 x A890
1 x A173
$216.00
Haplogroup Info
Other products
Currencies