Top » Catalog » R1b » A211

$18.00

A211
[A211]

A211
hg38 Position: ChrY:13761797..13761797
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Found in a R1b-CTS4466 person
Forward Primer: A211v2_F TTTTATTAAAATAGAGACAGGGCTTTG
Reverse Primer: A211v2_R AGGACATTAGCTCATTACTCTGGAC
Reviews

Customers who bought this product also purchased
A217
A217
A354
A354
A340
A340
A208
A208
A347
A347
A218
A218
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A306
1 x A1773
1 x A187
1 x A551
1 x A95
1 x A1322
1 x A410
1 x A975
1 x A135
1 x A359
1 x A510
1 x A337
1 x A629
1 x A467
1 x A1165
1 x A1161
1 x A462
1 x A1495
1 x A927
1 x A1269
1 x A1234
$378.00
Haplogroup Info
Other products
Currencies