Top » Catalog » R1b » A212

$18.00

A212
[A212]

A212
hg38 Position: ChrY:14159562..14159562
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b
Comments: Found in a R1b-CTS4466 person
Forward Primer: A212_F GAATTTTAGGATCTGTCCTCAGACTG
Reverse Primer: A212_R GCCCTTACCAATGCATTCTG
Reviews

Customers who bought this product also purchased
A6525
A6525
DF13
DF13
A7699
A7699
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
S1115
S1115
DF41
DF41
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies