Top » Catalog » R1b » A212

$18.00

A212
[A212]

A212
hg38 Position: ChrY:14159562..14159562
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b
Comments: Found in a R1b-CTS4466 person
Forward Primer: A212_F GAATTTTAGGATCTGTCCTCAGACTG
Reverse Primer: A212_R GCCCTTACCAATGCATTCTG
Reviews

Customers who bought this product also purchased
DF41
DF41
A6527
A6527
FGC11134
FGC11134
BY3535
BY3535
DF21
DF21
A6525
A6525
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2194
1 x A887
1 x A987
1 x A2201
1 x A458
1 x A189
1 x A1729
1 x A560
1 x A2070
1 x A669
1 x A411
1 x A923
1 x A321
1 x A217
1 x A613
1 x A992
1 x A1541
1 x A891
$324.00
Haplogroup Info
Other products
Currencies