Top » Catalog » R1b » A214

$18.00

A214
[A214]

A214
hg38 Position: ChrY:17406556..17406556
Ancestral: G
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b1
Comments: Found in a R1b-CTS4466 person
Forward Primer: A214v2_F AGAAGCTCAAGCCCGGTAAG
Reverse Primer: A214v2_R GGTAATCACAAAATTGTGCAAAC
Reviews

Customers who bought this product also purchased
A337
A337
DYS481
DYS481
A346
A346
A212
A212
A350
A350
A293
A293
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1260
1 x A1163
$36.00
Haplogroup Info
Other products
Currencies