Top » Catalog » R1b » A216

$18.00

A216
[A216]

A216
hg38 Position: ChrY:19205038..19205038
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b1
Comments: Found in a R1b-CTS4466 person
Forward Primer: A216_F GGCTGGAAGCAGGAGTAGTG
Reverse Primer: A216_R GGGGTGAAATAGGAGGATGG
Reviews

Customers who bought this product also purchased
A214
A214
A351
A351
A337
A337
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
A346
A346
A212
A212
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies