Top » Catalog » R1b » A217

$18.00

A217
[A217]

A217
hg38 Position: ChrY:19428489..19428489
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b1
Comments: Found in a R1b-CTS4466 person
Forward Primer: A217_F TTGTGGCAGAACACAGTTGG
Reverse Primer: A217_R GCCCCAAACCATTTCTTCTC
Reviews

Customers who bought this product also purchased
A206
A206
A341
A341
A214
A214
A351
A351
A337
A337
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1147
1 x A909
1 x A1204
1 x A628
1 x A2190
$90.00
Haplogroup Info
Other products
Currencies