Top » Catalog » R1b » A218

$18.00

A218
[A218]

A218
hg38 Position: ChrY:19899772..19899772
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b
Comments: Found in a R1b-CTS4466 person
Forward Primer: A218_F TAGGGCCTTGGGGAATTTAC
Reverse Primer: A218_R TCAAGGACTTGAACCCCAAG
Reviews

Customers who bought this product also purchased
A210
A210
A349
A349
A355
A355
A292
A292
A342
A342
A208
A208
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies