Top » Catalog » R1b » A218

$18.00

A218
[A218]

A218
hg38 Position: ChrY:19899772..19899772
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b
Comments: Found in a R1b-CTS4466 person
Forward Primer: A218_F TAGGGCCTTGGGGAATTTAC
Reverse Primer: A218_R TCAAGGACTTGAACCCCAAG
Reviews

Customers who bought this product also purchased
A347
A347
A206
A206
A352
A352
A216
A216
A338
A338
A341
A341
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies