Top » Catalog » R1b » A291

$18.00

A291
[A291]

A291
hg38 Position: ChrY:13642372..13642372
Ancestral: A
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1i (not listed)
Comments: Downstream S775
Forward Primer: A291_F CAGTGTCACCCTTCCAAACC
Reverse Primer: A291_R GATCCACCTTCCTCAGCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1496
1 x A598
1 x A530
$54.00
Haplogroup Info
Other products
Currencies