Top » Catalog » R1b » A287

$18.00

A287
[A287]

A287
hg38 Position: ChrY:8498142..8498142
Ancestral: A
Derived: G
Reference: John B. Sullivan (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1f2c3
Comments: Found in a R1b-Z253+ individual
Forward Primer: A287_F TGGATCTGATTTATGAGTGGTTTG
Reverse Primer: A287_R CTGGGTGATTGTCCCAGTG
Reviews

Customers who bought this product also purchased
CTS4314
CTS4314
Z2186
Z2186
FGC3249
FGC3249
Z2185
Z2185
A2298
A2298
L226
L226
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A498
$18.00
Haplogroup Info
Other products
Currencies