Top » Catalog » R1b » A287

$18.00

A287
[A287]

A287
hg38 Position: ChrY:8498142..8498142
Ancestral: A
Derived: G
Reference: John B. Sullivan (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1f2c3
Comments: Found in a R1b-Z253+ individual
Forward Primer: A287_F TGGATCTGATTTATGAGTGGTTTG
Reverse Primer: A287_R CTGGGTGATTGTCCCAGTG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2263
1 x A500
1 x A698
1 x A1168
1 x A2242
1 x A877
1 x A1271
1 x A449
1 x A177
1 x A1270
1 x A223
1 x A819
1 x A982
1 x A1367
1 x A2147
1 x A2140
1 x A2135
1 x A1304
1 x A915
1 x A1154
1 x A1370
$378.00
Haplogroup Info
Other products
Currencies