Top » Catalog » R1b » A292

$18.00

A292
[A292]

A292
hg38 Position: ChrY:14289054..14289054
Ancestral: A
Derived: G
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b1
Comments: .
Forward Primer: A292_F CTCATAAAGCCACATGATGGG
Reverse Primer: A292_R GAAACAACTTCCTAGATATATCACTGAATC
Reviews

Customers who bought this product also purchased
A293
A293
DYS481
DYS481
A344
A344
A211
A211
A349
A349
A217
A217
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies