Top » Catalog » R1b » A293

$18.00

A293
[A293]

A293
hg38 Position: ChrY:14651374..14651374
Ancestral: A
Derived: C
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: .
Forward Primer: A293_F TATTTGGCCCTGTTCATTTG
Reverse Primer: A293_R GAAAATCCAAAAGGATGGTTG
Reviews

Customers who bought this product also purchased
A212
A212
A350
A350
A292
A292
DYS481
DYS481
A344
A344
A211
A211
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1781
1 x A410
$36.00
Haplogroup Info
Other products
Currencies