Top » Catalog » R1b » A293

$18.00

A293
[A293]

A293
hg38 Position: ChrY:14651374..14651374
Ancestral: A
Derived: C
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: .
Forward Primer: A293_F TATTTGGCCCTGTTCATTTG
Reverse Primer: A293_R GAAAATCCAAAAGGATGGTTG
Reviews

Customers who bought this product also purchased
A216
A216
A352
A352
A338
A338
A206
A206
A341
A341
A214
A214
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A735
$18.00
Haplogroup Info
Other products
Currencies