Top » Catalog » R1b » A293

$18.00

A293
[A293]

A293
hg38 Position: ChrY:14651374..14651374
Ancestral: A
Derived: C
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: .
Forward Primer: A293_F TATTTGGCCCTGTTCATTTG
Reverse Primer: A293_R GAAAATCCAAAAGGATGGTTG
Reviews

Customers who bought this product also purchased
A211
A211
A349
A349
A217
A217
A355
A355
A342
A342
A210
A210
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies