Top » Catalog » R1b » A1729

$18.00

A1729
[A1729]

A1729
hg38 Position: ChrY:16158796..16158796
Ancestral: C
Derived: G
Reference: Terry Barton (2015)
ISOGG Haplogroup: R1b1a2a1a2b1b (not listed)
Comments: Approximately L196
Forward Primer: A1729_F CGGCTAATGTTTTTTGTATTTTTAATAAG
Reverse Primer: A1729_R GTATGTTCCCTTACAAATTCATACATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies