Top » Catalog » R1b » A295

$18.00

A295
[A295]

A295
hg38 Position: ChrY:2831783..2831783
Ancestral: A
Derived: G
Reference: Charles Moore (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1b1a2b
Comments: .
Forward Primer: A295_F AAAATAAAGGGATGGAGGAACATAC
Reverse Primer: A295_R TGCAGATAGCATTGTTTTCTTAATG
Reviews

Customers who bought this product also purchased
S511
S511
FGC918
FGC918
Z9
Z9
FGC924
FGC924
L47
L47
S272
S272
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies