Top » Catalog » R1b » A295

$18.00

A295
[A295]

A295
hg38 Position: ChrY:2831783..2831783
Ancestral: A
Derived: G
Reference: Charles Moore (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1b1a2b
Comments: .
Forward Primer: A295_F AAAATAAAGGGATGGAGGAACATAC
Reverse Primer: A295_R TGCAGATAGCATTGTTTTCTTAATG
Reviews

Customers who bought this product also purchased
S272
S272
A6886
A6886
R1b-L48 Panel
R1b-L48 Panel
Z326
Z326
FGC35559
FGC35559
S515
S515
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2164
1 x A1191
1 x A2135
1 x A560
$72.00
Haplogroup Info
Other products
Currencies