Top » Catalog » R1b » A300

$18.00

A300
[A300]

A300
hg38 Position: ChrY:16920089..16920089
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1a4a3
Comments: Approx. Z344
Forward Primer: A300_F CACCGCTCCTATACCACTCAC
Reverse Primer: A300_R TTTGGGTATTTTTGAAGGTGTC
Reviews

Customers who bought this product also purchased
S515
S515
S511
S511
Z326
Z326
L48
L48
S274
S274
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A171
$18.00
Haplogroup Info
Other products
Currencies