Top » Catalog » R1b » A298

$18.00

A298
[A298]

A298
hg38 Position: ChrY:8444893..8444893
Ancestral: A
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a1a1b1 (not listed)
Comments: Approx. Z344
Forward Primer: A298_F CATGAGTCATGATATAATGTCCTCC
Reverse Primer: A298_R GGTGACATATTGCTTGAGGCC
Reviews

Customers who bought this product also purchased
A299
A299
A300
A300
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1340
1 x A8
1 x A238
1 x A561
$72.00
Haplogroup Info
Other products
Currencies