Top » Catalog » R1b » A299

$18.00

A299
[A299]

A299
hg38 Position: ChrY:12251914..12251914
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1a4a3~
Comments: Approx. Z344
Forward Primer: A299_F GAGAGAAGAGAGACAGACCCTCTC
Reverse Primer: A299_R AGCTGTGCACAAAATCCCC
Reviews

Customers who bought this product also purchased
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
S515
S515
A5890
A5890
S511
S511
A5893
A5893
Z326
Z326
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A208
$18.00
Haplogroup Info
Other products
Currencies