Top » Catalog » R1b » A299

$18.00

A299
[A299]

A299
hg38 Position: ChrY:12251914..12251914
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1a4a3~
Comments: Approx. Z344
Forward Primer: A299_F GAGAGAAGAGAGACAGACCCTCTC
Reverse Primer: A299_R AGCTGTGCACAAAATCCCC
Reviews

Customers who bought this product also purchased
S511
S511
A5893
A5893
Z326
Z326
S274
S274
Z9
Z9
Z346
Z346
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A291
1 x A912
1 x A445
$54.00
Haplogroup Info
Other products
Currencies