Top » Catalog » R1b » A299

$18.00

A299
[A299]

A299
hg38 Position: ChrY:12251914..12251914
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1a4a3~
Comments: Approx. Z344
Forward Primer: A299_F GAGAGAAGAGAGACAGACCCTCTC
Reverse Primer: A299_R AGCTGTGCACAAAATCCCC
Reviews

Customers who bought this product also purchased
L48
L48
Z344
Z344
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
S515
S515
A5890
A5890
S511
S511
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A920
1 x A139
1 x A689
1 x A1162
1 x A808
1 x A1045
1 x A241
1 x A253
1 x A1247
$162.00
Haplogroup Info
Other products
Currencies