Top » Catalog » R1b » A309

$18.00

A309
[A309]

A309
hg38 Position: ChrY:8115098..8115098
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A309_F GGAAAAGAAAGGGAAGAGAAAAG
Reverse Primer: A309_R CTCATGCCTGTAACCTTGAGG
Reviews

Customers who bought this product also purchased
A306
A306
A308
A308
A307
A307
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies