Top » Catalog » R1b » A317

$18.00

A317
[A317]

A317
hg38 Position: ChrY:6872982..6872982
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c1a2a2a
Comments: .
Forward Primer: A317_F TGCATTTGTCTGTGGGTAGC
Reverse Primer: A317_R TTTTTCCCTCAAATCATCAGTC
Reviews

Customers who bought this product also purchased
S11515
S11515
S1791
S1791
DF96
DF96
A226
A226
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
S6961
S6961
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A128
1 x A2164
1 x A1017
1 x A1301
1 x A1101
1 x A1315
1 x A1202
1 x A1286
1 x A473
1 x A233
1 x A822
1 x A89
1 x A1053
1 x A2124
1 x A341
1 x A148
1 x A716
1 x A287
1 x A1052
1 x A526
1 x A519
1 x A979
$396.00
Haplogroup Info
Other products
Currencies