Top » Catalog » R1b » A319

$18.00

A319
[A319]

A319
hg38 Position: ChrY:12891891..12891891
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c1a2a2a
Comments: .
Forward Primer: A319_F ACCGAGATTGTGCTGTTGG
Reverse Primer: A319_R CTTGCTTCTTGTCATGCTTTG
Reviews

Customers who bought this product also purchased
A318
A318
A317
A317
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A514
1 x A1185
1 x A30
1 x A1333
1 x A98
1 x A138
1 x A1175
1 x A1783
1 x A991
1 x A1492
1 x A2152
1 x A474
1 x A804
1 x A388
1 x A2222
1 x A81
1 x A1710
1 x A58
1 x A1
1 x A1149
1 x A211
1 x A1282
1 x A2249
1 x A243
$432.00
Haplogroup Info
Other products
Currencies