Top » Catalog » R1b » A310

$18.00

A310
[A310]

A310
hg38 Position: ChrY:13805432..13805432
Ancestral: T
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1 (not listed)
Comments: .
Forward Primer: A310_F TGTGTGTACTGGATTGCACCA
Reverse Primer: A310_R TGAAGTTATCATCCACAGTGCAC
Reviews

Customers who bought this product also purchased
A312
A312
A311
A311
A315
A315
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2149
1 x A55
1 x A605
1 x A1494
1 x A1081
1 x A1159
1 x A461
1 x A742
1 x A996
1 x A750
1 x A542
1 x A208
1 x A1097
1 x A744
1 x A888
1 x A729
1 x A1002
$306.00
Haplogroup Info
Other products
Currencies