Top » Catalog » R1b » A311

$18.00

A311
[A311]

A311
hg38 Position: ChrY:16509304..16509304
Ancestral: A
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1 (not listed)
Comments: .
Forward Primer: A311_F CATGACTAGACCAGGTTGTTAAGTG
Reverse Primer: A311_R CTCAGGGAGAATGACTAAGGATG
Reviews

Customers who bought this product also purchased
A315
A315
A312
A312
A310
A310
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A658
1 x A977
$36.00
Haplogroup Info
Other products
Currencies