Top » Catalog » R1b » A312

$18.00

A312
[A312]

A312
hg38 Position: ChrY:16551040..16551040
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a
Comments: Downstream Z326 > FGC18842 > S21728 > PF740
Forward Primer: A312_F CAAAAGGAAATTATCACACATATGAC
Reverse Primer: A312_R TGGGGTTTGCCTATTCACTC
Reviews

Customers who bought this product also purchased
FGC18860
FGC18860
BY3326
BY3326
S21728
S21728
Z2
Z2
FGC564
FGC564
Z9
Z9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies