Top » Catalog » R1b » A312

$18.00

A312
[A312]

A312
hg38 Position: ChrY:16551040..16551040
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a
Comments: Downstream Z326 > FGC18842 > S21728 > PF740
Forward Primer: A312_F CAAAAGGAAATTATCACACATATGAC
Reverse Primer: A312_R TGGGGTTTGCCTATTCACTC
Reviews

Customers who bought this product also purchased
FGC18860
FGC18860
BY3326
BY3326
A655
A655
R1b-L48 Panel
R1b-L48 Panel
Z8
Z8
S21728
S21728
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A342
1 x A1080
1 x A694
1 x A2170
1 x A7
1 x A1766
1 x A1141
1 x A570
1 x A2071
1 x A683
1 x A2146
1 x A554
1 x A970
1 x A680
1 x A191
1 x A185
1 x A463
1 x A415
1 x A1201
1 x A445
1 x A1117
$378.00
Haplogroup Info
Other products
Currencies