Top » Catalog » R1b » A312

$18.00

A312
[A312]

A312
hg38 Position: ChrY:16551040..16551040
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a
Comments: Downstream Z326 > FGC18842 > S21728 > PF740
Forward Primer: A312_F CAAAAGGAAATTATCACACATATGAC
Reverse Primer: A312_R TGGGGTTTGCCTATTCACTC
Reviews

Customers who bought this product also purchased
FGC18860
FGC18860
BY3326
BY3326
R1b-L48 Panel
R1b-L48 Panel
Z8
Z8
S21728
S21728
Z2
Z2
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies