Top » Catalog » R1b » A321

$18.00

A321
[A321]

A321
hg38 Position: ChrY:6788731..6788731
Ancestral: G
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1a4b2a2b1
Comments: .
Forward Primer: A321_F GAGAATGAGGGCTGCTTTTG
Reverse Primer: A321_R GAATAGTGCATTGTAAAGAGGAAGATC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
A9030
A9030
L47
L47
Z11
Z11
S5246
S5246
R1b-L48 Panel
R1b-L48 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A599
1 x A212
1 x A586
1 x A232
$72.00
Haplogroup Info
Other products
Currencies