Top » Catalog » R1b » A323

$18.00

A323
[A323]

A323
hg38 Position: ChrY:14917629..14917629
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A323_F TCTTAGGTAGTCAGAACGCTGATG
Reverse Primer: A323_R TTCATTGTGCTTTTTCATCTCAG
Reviews

Customers who bought this product also purchased
Z1370.2
Z1370.2
FGC1389
FGC1389
A321
A321
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies