Top » Catalog » R1b » A368

$18.00

A368
[A368]

A368
hg38 Position: ChrY:14275263..14275263
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a2b (not listed)
Comments: Below L23 > Z2103
Forward Primer: A368_F GTGTCTACTCAAATTCATAGTGATGG
Reverse Primer: A368_R CTCAGTGGGCTCCAGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A121
1 x A1321
1 x A1544
1 x A2143
1 x A765
1 x A1164
1 x A682
1 x A636
1 x A326
1 x A190
1 x A227
1 x A443
1 x A660
1 x A300
1 x A1223
1 x A20
1 x A412
$306.00
Haplogroup Info
Other products
Currencies